Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 2166302
End position: 2166328
Length: 27

DNA sequence
>NC_019952, from 2166302 to 2166328 (27 bp); Mycobacterium canettii CIPT 140070017 CCGCCGTTGCCGCCGTTGCCGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2165654-2167201	Sequence	BN45_50104 PE_PGRS Conserved protein of unknown function, PE-PGRS family protein PE_PGRS34 (Protein is coded in complementary strand; from 2167201 to 2165654)