Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 2073781
End position: 2073807
Length: 27

DNA sequence
>NC_019952, from 2073781 to 2073807 (27 bp); Mycobacterium canettii CIPT 140070017 CGCCCCACCCGCCCCACCCGCCCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2072348-2075092	Sequence	BN45_50013 wag Conserved protein of unknown function, WAG22 antigen (Protein is coded in complementary strand; from 2075092 to 2072348)