Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 1720081
End position: 1720107
Length: 27

DNA sequence
>NC_019952, from 1720081 to 1720107 (27 bp); Mycobacterium canettii CIPT 140070017 CCGGCGCCGCCGGCGCCCCCGGCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1719661-1720743	Sequence	BN45_30566 PE_PGRS Conserved protein of unknown function, PE-PGRS family protein (Protein is coded in complementary strand; from 1720743 to 1719661)