Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 1679816
End position: 1679842
Length: 27

DNA sequence
>NC_019952, from 1679816 to 1679842 (27 bp); Mycobacterium canettii CIPT 140070017 CGCCGTTGCCGCCGTTGCCGCCGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1679620-1681095	Sequence	BN45_30532 PE_PGRS Conserved protein of unknown function, PE-PGRS family protein (Protein is coded in complementary strand; from 1681095 to 1679620)