Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 1415640
End position: 1415666
Length: 27

DNA sequence
>NC_019952, from 1415640 to 1415666 (27 bp); Mycobacterium canettii CIPT 140070017 CTGCCGCCGTTGCCGCCGCTGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1415217-1416068	Sequence	BN45_30277 - Conserved protein of unknown function, PE-PGRS family protein (Protein is coded in complementary strand; from 1416068 to 1415217)