Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 1247479
End position: 1247505
Length: 27

DNA sequence
>NC_019952, from 1247479 to 1247505 (27 bp); Mycobacterium canettii CIPT 140070017 CGGTGCCGCCGGTGCCGCCGGTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1246359-1248530	Sequence	BN45_30107 PE_PGRS Conserved protein of unknown function, PE-PGRS family protein (PE-PGRS 20) (part1) (Protein is coded in complementary strand; from 1248530 to 1246359)