Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 1244022
End position: 1244048
Length: 27

DNA sequence
>NC_019952, from 1244022 to 1244048 (27 bp); Mycobacterium canettii CIPT 140070017 TTGCCGCCGTTGCCGCCGTTGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1243872-1245893	Sequence	BN45_30104 PE_PGRS Conserved protein of unknown function, PE-PGRS family protein PE_PGRS19 (Protein is coded in complementary strand; from 1245893 to 1243872)