Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 1025496
End position: 1025540
Length: 45

DNA sequence
>NC_019952, from 1025496 to 1025540 (45 bp); Mycobacterium canettii CIPT 140070017 GCATTGCCGATGTTGCCGTTGCCGAGGTTGGCGTTGCCGATATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1024401-1026239	Sequence	BN45_20168 ppe Conserved protein of unknown function, PPE family, PPE13 (Protein is coded in complementary strand; from 1026239 to 1024401)