Sequence retrieval

Genome: Methanoregula formicicum SMSP
Start position: 540307
End position: 540330
Length: 24

DNA sequence
>NC_019943, from 540307 to 540330 (24 bp); Methanoregula formicicum SMSP GACGATGGCGATGACGAGGAGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 539300-540415	Sequence	Metfor_0540 - ABC-type transport system involved in multi-copper enzyme maturation, permease component (Protein is coded in complementary strand; from 540415 to 539300)