Sequence retrieval

Genome: Methanoregula formicicum SMSP
Start position: 2724091
End position: 2724114
Length: 24

DNA sequence
>NC_019943, from 2724091 to 2724114 (24 bp); Methanoregula formicicum SMSP GACCCGGGCCCGGACCCCGACCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2723603-2724328	Sequence	Metfor_2823 - ABC-type multidrug transport system, ATPase component (Protein is coded in complementary strand; from 2724328 to 2723603)