Sequence retrieval

Genome: Methanoregula formicicum SMSP
Start position: 2235258
End position: 2235281
Length: 24

DNA sequence
>NC_019943, from 2235258 to 2235281 (24 bp); Methanoregula formicicum SMSP AGGAGCAGGAACAGCAGCACGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2235114-2235701	Sequence	Metfor_2266 - hypothetical protein (Protein is coded in complementary strand; from 2235701 to 2235114)