Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 814092
End position: 814115
Length: 24

DNA sequence
>NC_019908, from 814092 to 814115 (24 bp); Brachyspira pilosicoli P43/6/78 TTTCTATATCTATTTTTAATTCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 813998-814195	Sequence	BPP43_03835 - hypothetical protein (Protein is coded in complementary strand; from 814195 to 813998)