Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 685632
End position: 685655
Length: 24

DNA sequence
>NC_019908, from 685632 to 685655 (24 bp); Brachyspira pilosicoli P43/6/78 TTATTTATTTTTTTATTTCTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 685645-686214	Sequence	BPP43_03265 - adenylate kinase (Protein is coded in complementary strand; from 686214 to 685645)