Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 650332
End position: 650361
Length: 30

DNA sequence
>NC_019908, from 650332 to 650361 (30 bp); Brachyspira pilosicoli P43/6/78 GGTCTGGTCTGGTCTGGTCTGGTCTGGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 650330-651439	Sequence	BPP43_03100 - glycosyltransferase (Protein is coded in complementary strand; from 651439 to 650330)