Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 492156
End position: 492179
Length: 24

DNA sequence
>NC_019908, from 492156 to 492179 (24 bp); Brachyspira pilosicoli P43/6/78 ATTTTTGTTTTTATTTATATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 490612-492345	Sequence	BPP43_02330 - hypothetical protein (Protein is coded in complementary strand; from 492345 to 490612)