Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 2152693
End position: 2152719
Length: 27

DNA sequence
>NC_019908, from 2152693 to 2152719 (27 bp); Brachyspira pilosicoli P43/6/78 GTATTTTCTATATTTTCTGTGTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2152387-2152728	Sequence	BPP43_10310 - 30S ribosomal protein S18 (Protein is coded in complementary strand; from 2152728 to 2152387)