Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 2033440
End position: 2033469
Length: 30

DNA sequence
>NC_019908, from 2033440 to 2033469 (30 bp); Brachyspira pilosicoli P43/6/78 TCATCATCATCATAATCATCTTCATCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2033209-2033595	Sequence	BPP43_09665 - hypothetical protein (Protein is coded in complementary strand; from 2033595 to 2033209)