Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 1768237
End position: 1768272
Length: 36

DNA sequence
>NC_019908, from 1768237 to 1768272 (36 bp); Brachyspira pilosicoli P43/6/78 TCTACTATATTATCTAATACATTATCTTCTATATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1767136-1768845	Sequence	BPP43_08440 - acetolactate synthase, large subunit (Protein is coded in complementary strand; from 1768845 to 1767136)