Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 1714139
End position: 1714168
Length: 30

DNA sequence
>NC_019908, from 1714139 to 1714168 (30 bp); Brachyspira pilosicoli P43/6/78 TATTATTTTTAATTATTTCTTTTTATTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1714162-1714257	Sequence	BPP43_08175 - hypothetical protein (Protein is coded in complementary strand; from 1714257 to 1714162)