Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 1501284
End position: 1501307
Length: 24

DNA sequence
>NC_019908, from 1501284 to 1501307 (24 bp); Brachyspira pilosicoli P43/6/78 TTCATTCTATCATTCTTCCATTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1500360-1501289	Sequence	BPP43_07105 - riboflavin biosynthesis protein (Protein is coded in complementary strand; from 1501289 to 1500360)
ORF... 1501294-1502241	Sequence	BPP43_07110 - hypothetical protein (Protein is coded in complementary strand; from 1502241 to 1501294)