Sequence retrieval

Genome: Brachyspira pilosicoli P43/6/78
Start position: 1316233
End position: 1316262
Length: 30

DNA sequence
>NC_019908, from 1316233 to 1316262 (30 bp); Brachyspira pilosicoli P43/6/78 AACTATTCTAAAAGATTCTAAATTATTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1316147-1316476	Sequence	BPP43_06240 - histidine triad (HIT) family protein (Protein is coded in complementary strand; from 1316476 to 1316147)