Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 846769
End position: 846796
Length: 28

DNA sequence
>NC_019776, from 846769 to 846796 (28 bp); Cyanobacterium aponinum PCC 10605 AACTCCGAACTCCGAACCCCGAACCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 846763-847746	Sequence	Cyan10605_0680 - glycosyl transferase family 2 (Protein is coded in complementary strand; from 847746 to 846763)