Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3625481
End position: 3625508
Length: 28

DNA sequence
>NC_019776, from 3625481 to 3625508 (28 bp); Cyanobacterium aponinum PCC 10605 TATTCACTATTAACTATTCACTATTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3625502-3626350	Sequence	Cyan10605_3059 - hopanoid biosynthesis associated protein HpnK (Protein is coded in complementary strand; from 3626350 to 3625502)