Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 908224
End position: 908268
Length: 45

DNA sequence
>NC_019702, from 908224 to 908268 (45 bp); Synechococcus sp. PCC 7502 TCCACTTAGATCGGCTCCACTTAGATCGGCTCCACTTAGATCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 908027-908866	Sequence	Syn7502_00910 - putative low-complexity protein (Protein is coded in complementary strand; from 908866 to 908027)