Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 539230
End position: 539268
Length: 39

DNA sequence
>NC_019702, from 539230 to 539268 (39 bp); Synechococcus sp. PCC 7502 TTGTTAATAAATCTGGTCAATAAATCTGGTCAATAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 539247-539951	Sequence	Syn7502_00527 - MazG family protein (Protein is coded in complementary strand; from 539951 to 539247)