Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 490384
End position: 490419
Length: 36

DNA sequence
>NC_019702, from 490384 to 490419 (36 bp); Synechococcus sp. PCC 7502 AGTCAATTTAATAGTCAATTAAACAGCCAATTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 490352-491749	Sequence	Syn7502_00486 - PLP-dependent enzyme, glutamate decarboxylase