Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 2904827
End position: 2904862
Length: 36

DNA sequence
>NC_019702, from 2904827 to 2904862 (36 bp); Synechococcus sp. PCC 7502 TACAAATTTAATTACAGATTTCATCACAAATTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2904396-2904851	Sequence	Syn7502_02960 - Oxygen evolving enhancer protein 3 (PsbQ) (Protein is coded in complementary strand; from 2904851 to 2904396)