Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 2546786
End position: 2546821
Length: 36

DNA sequence
>NC_019702, from 2546786 to 2546821 (36 bp); Synechococcus sp. PCC 7502 AGATTCAAGAGATGATTCAAGAGGCGATTTAAGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2545767-2547533	Sequence	Syn7502_02574 - diguanylate cyclase (GGDEF) domain-containing protein (Protein is coded in complementary strand; from 2547533 to 2545767)