Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 2074804
End position: 2074839
Length: 36

DNA sequence
>NC_019702, from 2074804 to 2074839 (36 bp); Synechococcus sp. PCC 7502 ACCTTCTTGGCGACCCTCTTGGCGACCCTCTTGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2074610-2075464	Sequence	Syn7502_02069 - hypothetical protein (Protein is coded in complementary strand; from 2075464 to 2074610)