Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 1620700
End position: 1620735
Length: 36

DNA sequence
>NC_019702, from 1620700 to 1620735 (36 bp); Synechococcus sp. PCC 7502 CAACCTCCACAAGCTCCACAACCTCCACAACCTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1620700-1621581	Sequence	Syn7502_01625 - hypothetical protein (Protein is coded in complementary strand; from 1621581 to 1620700)