Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 2047469
End position: 2047498
Length: 30

DNA sequence
>NC_019702, from 2047469 to 2047498 (30 bp); Synechococcus sp. PCC 7502 CTAATTTTTTCTAAATTTTCCTAAATATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2046849-2047469	Sequence	Syn7502_02035 - polyprenyl p-hydroxybenzoate/phenylacrylic acid decarboxylase (Protein is coded in complementary strand; from 2047469 to 2046849)