Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 3265141
End position: 3265167
Length: 27

DNA sequence
>NC_019702, from 3265141 to 3265167 (27 bp); Synechococcus sp. PCC 7502 CTCTAAAGGCTCTAAAGGCTCTAAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3263996-3265402	Sequence	Syn7502_03329 - hypothetical protein (Protein is coded in complementary strand; from 3265402 to 3263996)