Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 2866981
End position: 2867007
Length: 27

DNA sequence
>NC_019702, from 2866981 to 2867007 (27 bp); Synechococcus sp. PCC 7502 TAAACCAATTACACCAATTAAAACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2866913-2867767	Sequence	Syn7502_02924 - ABC-type nitrate/sulfonate/bicarbonate transport system, permease component (Protein is coded in complementary strand; from 2867767 to 2866913)