Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 257510
End position: 257536
Length: 27

DNA sequence
>NC_019702, from 257510 to 257536 (27 bp); Synechococcus sp. PCC 7502 TTGATTACTTTGATTATTTTGAGTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 257178-257639	Sequence	Syn7502_00253 - SH3 domain-containing protein (Protein is coded in complementary strand; from 257639 to 257178)