Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 3312462
End position: 3312485
Length: 24

DNA sequence
>NC_019702, from 3312462 to 3312485 (24 bp); Synechococcus sp. PCC 7502 TGGTTGTGGTAGTAGTTGTAGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3311618-3314281	Sequence	Syn7502_03375 - Calx-beta domain-containing protein,putative calcium-binding protein (Protein is coded in complementary strand; from 3314281 to 3311618)