Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 2811487
End position: 2811510
Length: 24

DNA sequence
>NC_019702, from 2811487 to 2811510 (24 bp); Synechococcus sp. PCC 7502 TAGCTTTAGCTCTATCTTCAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2811420-2811929	Sequence	Syn7502_02858 - micrococcal nuclease-like nuclease (Protein is coded in complementary strand; from 2811929 to 2811420)