Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 2442699
End position: 2442722
Length: 24

DNA sequence
>NC_019702, from 2442699 to 2442722 (24 bp); Synechococcus sp. PCC 7502 TAGATTTAAATTTTGATTTAGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2442355-2442999	Sequence	Syn7502_02456 - methylase involved in ubiquinone/menaquinone biosynthesis (Protein is coded in complementary strand; from 2442999 to 2442355)