Sequence retrieval

Genome: Synechococcus sp. PCC 7502
Start position: 1087233
End position: 1087256
Length: 24

DNA sequence
>NC_019702, from 1087233 to 1087256 (24 bp); Synechococcus sp. PCC 7502 TGCTCATACTCATGGTCAAGCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1087170-1090943	Sequence	Syn7502_01074 - PAS domain S-box (Protein is coded in complementary strand; from 1090943 to 1087170)