Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 4924991
End position: 4925035
Length: 45

DNA sequence
>NC_019689, from 4924991 to 4925035 (45 bp); Pleurocapsa sp. PCC 7327 GGCTTCTGTTAAATCTGCTTCGCTTAAATCGGCACCTTTTAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4924884-4925393	Sequence	Ple7327_4611 - putative low-complexity protein (Protein is coded in complementary strand; from 4925393 to 4924884)