Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 3843066
End position: 3843110
Length: 45

DNA sequence
>NC_019689, from 3843066 to 3843110 (45 bp); Pleurocapsa sp. PCC 7327 GCACCACTCAAATCGGTTTCACTCAAATCGGCTCCACTTAAATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3842688-3843230	Sequence	Ple7327_3604 - putative low-complexity protein (Protein is coded in complementary strand; from 3843230 to 3842688)