Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2809876
End position: 2809920
Length: 45

DNA sequence
>NC_019689, from 2809876 to 2809920 (45 bp); Pleurocapsa sp. PCC 7327 CTCAAATCGGCACCGCTCAAATTGGCTTCGCTCAAATTGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2809408-2810169	Sequence	Ple7327_2594 - putative low-complexity protein (Protein is coded in complementary strand; from 2810169 to 2809408)