Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2443603
End position: 2443647
Length: 45

DNA sequence
>NC_019689, from 2443603 to 2443647 (45 bp); Pleurocapsa sp. PCC 7327 TGTGGCTTTAGCTTGAGTCGCTTTAGCTTGAGCCGCTTTAGCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2443466-2444038	Sequence	Ple7327_2271 - hypothetical protein (Protein is coded in complementary strand; from 2444038 to 2443466)