Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2409960
End position: 2410004
Length: 45

DNA sequence
>NC_019689, from 2409960 to 2410004 (45 bp); Pleurocapsa sp. PCC 7327 GTTATTTCCTCCATTGTTGTTTCCTCCATTATTATTTCTTCTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2408122-2410110	Sequence	Ple7327_2244 - uncharacterized protein predicted to be involved in DNA repair (RAMP superfamily) (Protein is coded in complementary strand; from 2410110 to 2408122)