Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 785204
End position: 785245
Length: 42

DNA sequence
>NC_019689, from 785204 to 785245 (42 bp); Pleurocapsa sp. PCC 7327 TTGGATTTTGGATTTTCGATTTTGGATTTTCGATTTTGGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 784531-786195	Sequence	Ple7327_0738 - signal transduction histidine kinase (Protein is coded in complementary strand; from 786195 to 784531)