Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2417675
End position: 2417716
Length: 42

DNA sequence
>NC_019689, from 2417675 to 2417716 (42 bp); Pleurocapsa sp. PCC 7327 TAATAATGAATGATGAATGATGAATGATGAATGATGAATGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2416435-2417676	Sequence	Ple7327_2250 - hypothetical protein (Protein is coded in complementary strand; from 2417676 to 2416435)