Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 4139631
End position: 4139666
Length: 36

DNA sequence
>NC_019689, from 4139631 to 4139666 (36 bp); Pleurocapsa sp. PCC 7327 TCTCCCTTATCTCCCTTATCTCCCTTATCTCCCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4132874-4141402	Sequence	Ple7327_3888 - polyketide synthase family protein (Protein is coded in complementary strand; from 4141402 to 4132874)