Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 1130682
End position: 1130717
Length: 36

DNA sequence
>NC_019689, from 1130682 to 1130717 (36 bp); Pleurocapsa sp. PCC 7327 GCCCATGCCACCCATGCCGCCCATACCACCCATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1130674-1132326	Sequence	Ple7327_1064 - chaperonin GroL (Protein is coded in complementary strand; from 1132326 to 1130674)