Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 4431511
End position: 4431545
Length: 35

DNA sequence
>NC_019689, from 4431511 to 4431545 (35 bp); Pleurocapsa sp. PCC 7327 CAAATGACTAATGACAAAAGACAAAGGACAACTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4431023-4431847	Sequence	Ple7327_4147 - pyrimidine reductase, riboflavin biosynthesis