Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 1127619
End position: 1127653
Length: 35

DNA sequence
>NC_019689, from 1127619 to 1127653 (35 bp); Pleurocapsa sp. PCC 7327 ACTTCCGATTTCCGACTTCCGACTTCTGACTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1126662-1130348	Sequence	Ple7327_1063 - condensin subunit Smc (Protein is coded in complementary strand; from 1130348 to 1126662)