Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 1910753
End position: 1910782
Length: 30

DNA sequence
>NC_019689, from 1910753 to 1910782 (30 bp); Pleurocapsa sp. PCC 7327 ACCAAAAAAATCCAAAATAAATCAAAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1909910-1910794	Sequence	Ple7327_1783 - ClpP class periplasmic serine protease (Protein is coded in complementary strand; from 1910794 to 1909910)